miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes

Abstract

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of theSPLandHAMgenes inA. thaliana. miRNAs from the miR156 and miR157 families inA. thalianaare shown to have binding sites within the mRNAs ofSPLgenes. The ath-miR156a–j binding sites located in the mRNAs of theSPLparalogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of theSPLfamily at the same site. We suggest merging the miR156 and miR157 families into one family. SeveralSPLgenes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 inHAM1,HAM2, andHAM3paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within theHAM1,HAM2, andHAM3miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.