A novel 29 bp insertion/deletion (indel) variant of the <i>LHX3</i> gene and its influence on growth traits in four sheep breeds of various fecundity

Abstract

Abstract. Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ2 test (P < 0.05). Association analyses showed that body length was significantly different in female TS and STHS and that chest width was significantly different for the female TS and male STHS (P < 0.05). These findings suggested that the 29 bp indel could extend the spectrum of genetic variations of the LHX3 gene in sheep and provide a valuable theoretical basis for the marker-assisted selection (MAS) in sheep breeding and genetics.