Aptasensing Ampicillin on Silica Substrate Gapped by Interdigitated Aluminium Electrode

Abstract

Background: Ampicillin has been widely used as a broad-spectrum antibiotic for the treatment and prevention of human diseases with a low-toxicity. Ampicillin plays an important role in therapeutics, however, there might be some synthetically prepared compounds for the applications in agriculture, animals and even humans that eventually have resulted in major health issues. Objective: This research demonstrates the approach to improve the specific in vitro detection of ampicillin using titanium dioxide nanoparticle-based interdigitated device electrode. Methods: The fabrication of biosensor was performed using the conventional photolithography integrated process of an inductively-coupled plasma dry-etching. Surface modifications were applied on a 50 µm gapped interdigitated comb-like titanium dioxide nanoparticle modified electrode surface using 0.02 M of 3-Aminopropyl trimethoxysilane, which was diluted in 75% ethanol. A Schiff-base reaction using glutaraldehyde was followed to covalently immobilize streptavidin followed by a non-covalent immobilization of biotinylated-aptamer DNA probe (1 µM), having a sequence of 5’- CACGGCATGGTGGGCGTCGTG–biotin-3’. Results: These surface modifications with multiple self-assembling monolayers afford the additional control for stability. The immobilized aptamer DNA probe was interacted with the target, ampicillin at 10 mg/ml, resulting in the current field changes across the device. I-V relationship interpreted the selective binding of ampicillin and distinguished kanamycin from carbenicillin. Our sensing system was able to detect ampicillin in a linear range of 0.1 ng until 10 mg/ml with the limit of detection at 0.1 ng/ml. Conclusion: This sensing platform aimed to evaluate the purity of ampicillin, a promising beneficial approach towards the pharmaceutical industries.