1. Gosline J., DeMont M., Denny M., Endeavour 10, 37 (1986).
2. Hayashi C., Lewis R., J. Mol. Biol. 275, 773 (1998).
3. A λFixII (Stratagene) library of N.c. genomic DNA was a gift from M. Hinman. A λGem-12 (Promega) library was constructed from N.m. genomic DNA. Libraries were screened with the radiolabeled oligonucleotide CCWCCWGGWCCNNNWCCWCCWGGWCC (W = A or T; N = A G C or T). Flag inserts were subcloned into pGEM (Promega) vectors and sequenced in both directions with universal or gene-specific primers. To sequence through long highly repetitive regions sets of nested deletions were created with the Erase-A-Base kit (Promega) or transposons were inserted using the Genome Priming System (New England Biolabs). An additional 2.8 kb of the Flag gene from N.c. was amplified by polymerase chain reaction with the primers CGCTTCTGAAACGAAAAAGG and GCGAACATTCTTCCTACAGA ligated into pGEM3z-f(+) (Promega) and duplicate clones were sequenced as described above.
4. Structure of a protein superfiber: spider dragline silk.
5. Isolation of a clone encoding a second dragline silk fibroin. Nephila clavipes dragline silk is a two-protein fiber.