In-silico Gene Editing of LCYB in Musa acuminata and Its Functional Analysis Related to Lycopene Beta-Cyclase Pathway

Abstract

Abstract Banana (Musa acuminata) has high biodiversity and belongs to the important commodities after rice, particularly in Indonesia. for effective biofortification of bananas, a thorough understanding of the fruit’s genetic makeup, nutritional composition, and bioavailability of nutrients is necessary. If the study of bananas is incomplete or lacking, it can impede the development of biofortified varieties. The gene-regulated vitamin A pathway in a banana is LCYB. Therefore, this study aimed to design activating LCYB gene using CRISPR/Cas 9 and predict its gene and protein functional analysis related to the lycopene beta-cyclase pathway. We performed sequence analysis of LCYB (GeneBank: KP406755.1) to construct sgRNA to activate the expression of LCYB by in-silico approaches. We also successfully amplified the LCYB gene in various accession collections. Based on in-silico predicting sgRNA activity, we found a total of 192 putative sgRNA both in the positive or negative strand in the M.acuminata LCYB gene sequence. We investigated three sgRNA targets sequence-related MaLCYB activation, i.e., CTTTAGATGAGTCATACAAGGGG, ACGAGAGTTCACTACCCAAGAGG, and AGAATTGAGTTGCTCCACCGAGG with an efficiency score of 73.23, 71.00, and 70.21%, respectively. The mutation of the gene could change the functional protein and influence the lycopene beta-cyclase pathway. In silico analysis was an important tool to predict genome editing in M.acuminata to minimize technical sgRNA construction in vivo.