A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization

Abstract

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.