Genotyping of Uridine-Diphosphate Glucuronosyltransferases-1A1 (UGT1A1) Enzyme and Its Genetic Variant Allele Determination Using Polymerase Chain Reaction and Gel Electrophoresis

Abstract

Dolutegravir is an integrase inhibitor that prevents the integration of the viral genome into the host cell’s DNA, thus halting HIV replication. The study aimed to conduct genotyping of immunocompromised patients in some Southern States of Nigeria on dolutegravir-based highly active antiretroviral therapy for the UGT1A1*6 and UGT1A1*28 variant alleles using gel electrophoresis and polymerase chain reaction. 52 HIV/AIDS patients participated in the study. Specific primers for UGT1A1*6 and UGT1A1*28: U1F1 forward primer: 5 – AGATACTGTTGATCCCAGTG - 3 and U211R reverse primer: 5 - CTTCAAGGTGTAAAATGGTC-3, was used for the gene amplification, followed by restriction digestion with Ava II. DNA concentrations were quantified with a NanoDrop-1000 spectrophotometer. Restriction fragment length polymorphism (RFLP) techniques were used for genotyping and Gel electrophoresis to determine the heterozygosity and homozygosity of UGT1A1 alleles. After the polymerase chain reaction (PCR), all DNA samples appeared at 280 base pairs on a 1% agarose gel electrophoretic medium. RFLP analysis confirmed the PCR results; thus, no mutations were observed in all the samples. There were no UGT1A1 genetic polymorphisms among the ethnic groups studied, although there was a mild significant link between dolutegravir and neuropsychiatric side effects in the patients (at p-value = 0.08).