First Report of Potato mop-top virus on Potatoes in Washington State

Abstract

In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea, which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States. References: (1) N. David et al. Plant Dis. 94:1506, 2010. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) H. Xu et al. Plant Dis. 88:363, 2004.