The First Report of Tomato torrado virus in Poland

Abstract

In 2003 and 2004, unusual disease symptoms, including severe stunting, malformation, and necrosis of the leaves on tomato cv. Grace, were observed in the Wielkopolska Region of Poland. The disease appeared to be associated with the presence of the greenhouse whitefly Trialeurodes vaporariorium. An electron microscopic examination of a negatively stained leaf-dip preparation from an infected plant showed the presence of spherical virus particles approximately 25 to 28 nm in diameter. The virus (designated Wal'03) was shown to be vectored efficiently (100%) by T. vaporariorium and poorly (50 to 70%) by mechanical transmission to tomato. Mechanical inoculation or whitefly transmission caused systemic infection on Nicotiana tabacum (cvs. Xanthi nc, Samsun, and White Burley), N. benthamiana, N. clevelandii, N. debneyi, N. affinis, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, Capsicum annuum, Nicandra physaloides, Physalis floridana, and Solanum tuberosum. The virus did not infect Phaseolus vulgaris, Pisum sativum, Cucumis sativus, Chenopodium quinoa, or Beta vulgaris. Partially purified virus preparations from N. bethamiana or N. tabacum cv. Xanthi centrifuged in a sucrose density gradient sedimented as two separated zones. Viral RNA was extracted from the purified viral preparations with phenol-chloroform, and analysis by denaturing agarose gel electrophoresis revealed RNA 1 (approximately 7,800 bp) and RNA 2 (approximately 5,400 bp). The biological properties and the genomic RNA composition showed significant similarities to that of Tomato necrotic dwarf virus (ToNDV) described from California (1) and the newly identified Tomato torrado virus (ToTV) in Spain (2). Immuno-specific electron microscopy (ISEM) showed Wal'03 virus particles reacted with ToNDV antiserum (provided by W. Wintermantel, Salinas, CA). The genomic sequence of ToTV (GenBank Accession Nos. DQ388879 and DQ388880) was used to design specific primers for analysis by reverse transcription (RT)-PCR: TR1F (5′ CAATGTGCCAAAGATGAGCG 3′), TR1R (5′ ACTCCCGTGTCTATGTTTTC 3′), TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′), which amplified products of 573 and 892 bp for RNA 1 and RNA 2, respectively. These RT-PCR fragments from Wal'03 were sequenced (GenBank Accession Nos. EF635007 and EF635008) and comparisons with ToTV showed 99 and 98% nucleotide identity for RNA1 and RNA2, respectively. Immunocapture-RT-PCR with leaf tissue from N. benthamiana infected by Wal'03, antiserum against ToNDV, and ToTV-specific primers TR2F and TR2R produced a fragment of the expected size. Sequence of this product showed 100% identity with previously obtained RT-PCR fragments. The similarity of the symptoms on tomato plants, the morphology of virus particles, genome composition and nucleotide sequence identities suggest that Wal'03 and ToTV are the same. References: (1) R. C. Larsen et al. Phytopathology 74:795, 1984. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007.