First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic

Abstract

Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5′ATGTCTAAGGTCAAGCTCACC3′ and NR5′TTATGCAACACCTGAAATTTTGGC3′), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.