First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World

Abstract

During the fall of 2013, endive (Cichorium endivia L.) and escarole (C. endivia ssp. latifolia) fields in New Jersey were found with severe disease symptoms. The cores of the heads were necrotic and rotted, while outer leaves were yellow with more pronounced yellowing of veins and occasional veinal necrosis. The disease occurred in plants grown in sandy loam soils, and developed following a period of extended soil moisture; most escarole and endive in the ground at that time developed symptoms. Similar symptoms have been observed for 15 to 20 years in the area and are commonly referred to as yellows. Initial ELISA tests (Agdia) identified tombusvirus infection in two composite samples of 10 plants each from two fields. To confirm tombusvirus infection and determine which tombusvirus was responsible, RNA was extracted from four plant samples using the RNeasy Plant Mini Kit (Qiagen). Complimentary DNA was synthesized using Maxima reverse transcriptase (Fermentas) and random primers. PCR was performed using GenScript enzymes (Genscript) and virus species specific primer sets designed to amplify a portion of the coat protein gene of either Tomato bushy stunt virus (TBSV) or Moroccan pepper virus (MPV) (2,3), the two tombusviruses responsible for a disease of lettuce that develops under similar environmental conditions. All samples tested negative for TBSV, but one sample of escarole was positive for MPV using primers MPVcp2766F 5′ CGGTAAGATTGTAGGGTTCATGGTGG 3′; and MPVcp3603R 5′ TGCTCCAGTGTCACGGAAGT 3′, which amplify an 837-nt section of the MPV coat protein gene. Direct sequencing confirmed 94% identity with an isolate of MPV from Japan (AB704411) and 97% identity to isolates from Morocco (JX197071) and California (JN700748) (3). Secondary confirmation was obtained with an additional primer set designed to amplify a 372-nt region of ORF1 of select tombusviruses (Tombus270F 5′ TGAGATACATGAGGACAGG 3′; and Tombus642R 5′ AGCTTAAATACCGACAGTT 3′). Direct sequencing confirmed 96 (AB704411) to 99% (JX197071) identity to MPV isolates from Japan and Morocco, respectively. Eight additional samples of symptomatic escarole from three farms were tested, and two samples reacted positive to MPV using the methods described above. Attempts at mechanical transmission of virus from escarole to known hosts of MPV were unsuccessful; however, transmission of MPV from infected lettuce (Lactuca sativa L.) is often low efficiency as well; therefore, this result was not surprising. To our knowledge, this is the first report of MPV in escarole anywhere in the world, and the first report of MPV in a United States field crop outside of California and Arizona. MPV and TBSV are known to cause the disease, lettuce dieback, in the western United States. Like yellows on escarole, lettuce dieback is associated with saturated soils (1) and other stress factors (Wintermantel, unpublished). Further studies will be needed to determine if MPV is the sole cause of yellows in escarole and endive or if it is part of a disease complex; however, the identification of MPV in this important leafy greens production region and its association with yellowing and core rot symptoms in escarole warrant further study of the association of MPV and potentially other tombusviruses with yellows of escarole. References: (1) C. Obermeier et al. Phytopathology 91:797, 2001. (2) W. M. Wintermantel and A. G. Anchieta. Arch. Virol. 157:1407, 2012. (3) W. M. Wintermantel and L. L. Hladky. Phytopathology 105:501, 2013.