First Report of Tomato leaf curl Palampur virus on Bitter Gourd in Pakistan

Abstract

Bitter gourd (Momordica charantia L.) is widely grown and consumed as a vegetable in Pakistan and other countries in the region. In 2007, a severe disease appeared on bitter gourd that reduced yield significantly. Symptoms of the disease included chlorosis, leaf crumpling, vein thickening, and stunting of plants that were suggestive of a virus infection. Symptomatic leaf samples were collected from fields in the vicinity of Faisalabad, Pakistan (Thikriwala, 12 km from Faisalabad, 31°22′0″N, 72°53′0″E). Seven infected samples were tested for the presence of Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus, Papaya ringspot virus, Melon necrotic spot virus, and Squash mosaic virus by double-antibody sandwich-ELISA according to the manufacturer's instructions (Bio-Rad, Hercules, CA). All samples of bitter gourd were found to be negative for all five RNA viruses, whereas melon samples collected from the same area (Thikriwala) were infected by ZYMV as reported earlier (3). Samples were also screened for begomoviruses by molecular tests. Total DNA was extracted with the cetyltrimethylammoniumbromide method (4). All seven symptomatic samples were positive for a begomovirus when DNA A of Tomato leaf curl New Delhi virus (ToLCNDV) was used as a general probe by Southern hybridization. A probe of the movement protein (MP) gene of ToLCNDV was also positive by Southern hybridization, suggesting the infection of a bipartite begomovirus. The presence of a begomovirus was confirmed by PCR with universal primers designed for amplification of begomoviruses (BegomoRe F 5′ACGCGT GCCGTGCTGCTGCCCCCATTGTCC3′ and BegomoRe R 5′ACGCGT ATGGGCTGYCGAAGTTSAGACG3′). A fragment of the expected length (approximately 2.8 kb) was cloned in a T/A cloning vector (ptz57R/t; Fermentas, Burlington, Ontario, Canada) and partially sequenced. Sequence analysis of partial sequences (925 bp, GenBank Accession No. FN555137; 719 bp, GenBank Accession No. FN555138) showed maximum identity (97%) with Tomato leaf curl Palampur virus (ToLCPaV) recently reported from India and Iran (1,2). To our knowledge, this is the first report of ToLCPaV in Pakistan and the first report of the virus on bitter gourd. References: (1) J. Heydarnejad et al. Arch. Virol. 154:1015, 2009. (2) Y. Kumar et al. Virus Genes 38:193, 2009. (3) A. H. Malik et al. Plant Pathol. 55:285, 2006. (4) M. G. Murray and W. F. Thompson. Nucleic Acids Res.8:4321, 1980.