Evidence that Watermelon Leaf Curl Disease in Pakistan Is Associated with Tomato Leaf Curl Virus-India, a Bipartite Begomovirus

Abstract

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.