First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas

Abstract

Since the first report of the ‘spotted wilt’ disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.