First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America

Abstract

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.