Outbreak of Bacterial Spot (Xanthomonas cucurbitae) in Pumpkin Fields in Illinois

Abstract

About 10,000 ha of pumpkins [Cucurbita pepo L. and Cucurbita moschata (Duchesne) Duchesne ex Poir] are produced annually in Illinois. In 2010 and 2011, severe leaf and fruit symptoms typical of bacterial spot caused by Xanthomonas cucurbitae (ex Bryan) Vauterin et al. were observed in pumpkin fields in Illinois, resulting in estimated yield losses of 3 to 90%. Leaf infection was observed from the time of spreading vines until harvest, and infection of fruit occurred from when fruit weights were 0.25 kg until harvest. Leaves had small (2 to 4 mm), angular, yellow spots (1). Fruit had small (1 to 3 mm in diameter), slightly sunken, circular spots, each with a beige center and dark brown halo (1). A survey in 2010 showed that bacterial spot occurred in 40 of 50 pumpkin fields with symptoms on 3 to 94% of fruit in a field (average 34%). A survey in 2011 showed fruit with bacterial spot symptoms in 57 of 65 pumpkin fields, with lesions on 3 to 87% of the fruit in a field (average 24%). Six to twelve symptomatic pumpkins were collected from each field, and X. cucurbitae was isolated from the fruit by surface-disinfesting an area of the fruit with lesions with paper tissue soaked in 95% ethanol. One or two lesions/fruit were cut out with a sterile blade, inserted into an eppendorf tube containing 1 ml of sterile distilled water (SDW), the tubes shaken manually, and a loopful of the bacterial suspension from each tube streaked onto nutrient agar (NA). The plates were incubated at 24°C for 3 to 4 days. Single colonies of each of the isolated bacterium were prepared by streaking isolated colonies onto additional plates of NA and selecting well-separated colonies. The colonies were identified as X. cucurbitae by culturing on yeast extract-dextrose–CaCO3 (YDC) agar, on which xanthomonas-like yellow colonies with mucoid growth developed. The isolates were gram-negative, O+ and F– in the oxidative and fermentative test, oxidase negative, and motile. The isolates hydrolyzed starch and esculin, but did not hydrolyze nitrate, and grew on YDC agar at 33°C. Confirmation of the species identity was achieved using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay (2), which produced a 1,500-bp band. Koch's postulates were carried out for 40 isolates of X. cucurbitae from 40 different fields on pumpkin cv. Howden in a greenhouse. Koch's postulates for five of the isolates were also conducted in a field. Bacterial inoculum was cultured on Luria Broth agar medium and a suspension of 108 cfu/ml prepared in SDW. Pumpkin leaves and fruit were spray-inoculated. In the greenhouse test, each isolate was inoculated onto five leaves of each of four plants. In the field, each isolate was inoculated onto 10 leaves and one fruit of each of 10 plants. A positive control treatment consisted of inoculating pumpkin leaves and fruit with a known X. cucurbitae isolate. A negative control treatment entailed using SDW for inoculation. Lesions developed on leaves and fruit of plants inoculated with the positive control and suspected X. cucurbitae isolates. X. cucurbitae was reisolated from symptomatic leaves and fruit and identified by culturing on YDC agar, and using the PCR assay. No symptoms developed on leaves or fruit sprayed with SDW, and attempts to isolate X. cucurbitae from these plants did not result in development of any bacterial colonies. References: (1) Babadoost et al. Univ. of Illinois Extension C1392, 2004. (2) Leite et al. Appl. Environ. Microbiol. 60:1068, 1994.