Crystal Structure of an i‐Motif from the HRAS Oncogene Promoter

Abstract

AbstractAn i‐motif is a non‐canonical DNA structure implicated in gene regulation and linked to cancers. The C‐rich strand of the HRAS oncogene, 5′‐CGCCCGTGCCCTGCGCCCGCAACCCGA‐3′ (herein referred to as iHRAS), forms an i‐motif in vitro but its exact structure was unknown. HRAS is a member of the RAS proto‐oncogene family. About 19 % of US cancer patients carry mutations in RAS genes. We solved the structure of iHRAS at 1.77 Å resolution. The structure reveals that iHRAS folds into a double hairpin. The two double hairpins associate in an antiparallel fashion, forming an i‐motif dimer capped by two loops on each end and linked by a connecting region. Six C−C+ base pairs form each i‐motif core, and the core regions are extended by a G−G base pair and a cytosine stacking. Extensive canonical and non‐canonical base pairing and stacking stabilizes the connecting region and loops. The iHRAS structure is the first atomic resolution structure of an i‐motif from a human oncogene. This structure sheds light on i‐motifs folding and function in the cell.