CDKN1B mutation analyses and biochemical characteristics in patients with symptomatic or asymptomatic primary hyperparathyroidism

Abstract

Purpose: The aim of this study was to compare clinical, biochemical and treatment modalities of the patients with symptomatic and asymptomatic PHPT (primary hyperparathyroidism), and evaluate whether the CDKN1B mutation from these patients contributes to the pathogenesis of typical, sporadic parathyroid adenomas. Materials and Methods: In this prospective study 80 patients (66 women and 14 men, mean age 50.8 ± 12.01 years) with PHPT were enrolled. Biochemical and clinical information were collected on patients’ sex, age, biochemical examination and radiological findings (nuclear 99 mTc sestamibi scans scintigraphy, cervical ultrasound). CDKN1B sequencing, and DNA isolation was performed by using GeneMATRIX Quick Blood DNA Purification Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) were amplified by polymerase chain reaction (PCR) (Solis Biodyne, Estonia). Results: A total of 80 patients diagnosed with PHPT were included, of which 22 were symptomatic. Serum calcium and 24-hour calcium excretion were significantly increased in patients with symptomatic PHTP. Serum PTH levels were similar between the two group. PHPT. CDKN1B mutation was not detected in any patients. Conclusion: Symptomatic patients were found to have elevated levels of calcium levels (hypercalcaemic), 24-hour urine calcium excretion and target organ damage (bone disease and nephrolithiasis). Independent of PTH levels, clinical signs and symptoms could be related with serum calcium parameters in these patients.