Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat

Abstract

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS600 could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.