Abstract
Abstract
Grape (Vitis vinifera L.) is an important fruit crop of India with about 3,489,000 MT of production from an area of 111,000 ha. Karnataka state is the major producer of grapes contributing about 25 per cent to the total production. Downy mildew disease caused by Plasmopara viticola (Berk. & Curt.) is the major threat to grape production in the world. Several fungicides have been used for the management of downy mildew in grapevine, quinone outside inhibitor (QoI) fungicides are the major among them and have been successfully used in Karnataka state for about a decade. However, in the recent year’s farmers noticed failure of QoI fungicides in the management of downy mildew and there are reports of presence of resistance in different parts of the world (Sawant et al. 2016). In the present study, 41 field collected downy mildew samples across major grapevine growing districts of Karnataka state during 2022-23 were analysed for their presence of QoI resistance. Sensitivity to QoI fungicide was determined using a modified 24-well leaf-disc bioassay (FRAC 2003). Healthy leaves were taken from the 6th node from the apex of a growing shoot of the downy mildew susceptible grapevine cultivar, ‘Thomson Seedless’ and 15 mm disks were cut. The leaf disks were placed upside down in wells containing 1 ml of 0.5 per cent water agar amended with 0, 1, 10, 50, 100, and 1,000 μg ml-1 of azoxystrobin 23% SC (Amistar, Syngenta) and kresoxim methyl technical grade 94% (Ergon, Rallis India Lt.) separately as described by Sawant et al. (2016). Each treatment was repeated four times. Leaf disks were then inoculated with 10 μl of 50,000 sporangia ml-1 suspension of P. viticola collected from a single lesion. Plates were incubated at 22°C with alternating periods of 12 hours light and dark. After six days, lesion area was measured and EC50 value was calculated by regression analysis of per cent area of infection versus log10 fungicide concentration and resistant factor was also determined as described by Massi et al. (2021). The EC50 value of sensitive isolates to azoxystrobin ranged from 0.13 to 6.25 µg ml-1 with 0 resistant factor (RF). The EC50 value ranged from 12.58 to 46.65 µg ml-1 in moderately resistant isolates with 3.02-11.32 RF, and resistant isolates ranged from 31.56 to 52.36 µg ml-1 with RF of 7.66-12.71 while, that of the highly resistant isolates ranged from 89.68 to 156.25 µg ml-1 with RF of 21.77-37.92. The EC50 value of sensitive isolate to kresoxim methyl ranged from 0.03 to 4.12 µg ml-1 with 0 RF. The EC50 value ranged from 14.05 to 18.45 µg ml-1 in moderately resistant isolates with RF of 6.77-8.81 and resistant isolates ranged from 14.03 to 29.12 µg ml-1 with RF (25.23-52.36) while that of the highly resistant isolates ranged from 78.56 to 196.54 µg ml-1 with RF of 37.86-94.72. The resistance to QoI fungicides in P. viticola was developed due to the mutation in the cytochrome b (cyt b) gene at G143A site, this can be detected by polymerase chain reaction using allele-specific primers GGGGTTTGTATTACGGATCT (Forward) and GGATATTTGAACCTACCTC (Backward) as described by Ghule et al. (2020). Total DNA was isolated from all the isolates using MN kit as per the manufactures protocol (Macherey-Nagel, Germany) and the quality was assed using Qubit® 3.0 fluorometer (Thermo Fisher Scientific) before being subjecting to thermocycler using allele-specific primers. Among 41 isolates, 34 isolates produced the amplicon of 315 bp size (Figure 1) which indicate an G143A amino acid mutation in cyt b gene associated with resistance to QoI fungicides. Remaining seven isolates do not produce amplicon, indicating there is absence of G143A site mutation. To our knowledge this is the first case of occurrence of QoI resistance in P. viticola in Karnataka state. Further monitoring of resistance to QoI fungicides in P. viticola population is required, in order to alert grower community for alternate use of fungicides for effective management of disease.
Publisher
Research Square Platform LLC
Reference4 articles.
1. FRAC, Monitoring Methods (2013) : PLASVI microtiter 2003-12. Fungicide Resistance Action Committee, CropLife International, Brussels, Belgium. Retrieved from athttp://www.frac.info/monitoring-methods Aug. 9,
2. Evolution and Detection in Plant Pathogens: Plasmopara viticola as a Case Study;Massi F;Microorganisms,2021
3. Resistance of Plasmopara viticola to multiple fungicides in vineyards of Maharashtra, India;Ghule MR;J Environ Biol,2020
4. First report of QoI Resistance in Plasmopara viticola from Vineyards of Maharashtra, India;Sawant S;Plant Dis,2016