Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia-Telangiectasia Patients: Introducing Three Novel Mutations

Abstract

Abstract Background: Ataxia Telangiectasia (AT) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ATM gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. The classic neurological signs of AT include progressive cerebellar ataxia, oculomotor abnormalities, movement disorders, and cognitive dysfunction. The condition presents with multisystem involvement, leading to immunodeficiency‚ cancer predisposition, oculocutaneous telangiectasia‚ and elevated serum alpha-fetoprotein levels. In this study, we review the clinical characteristics of 13 AT patients, 3 of whom displayed novel mutations. Method : Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing (WES); in the other 3 patients, polymerase chain reaction (PCR) was used, followed by sequencing. The mutations found via WES were confirmed by Sanger sequencing. Results: We identified 11 different mutations in ATMgene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 3 likely pathogenic mutations (ie, c.4864G>T, c.2639-1G>A, and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported. All parents showed a heterozygous state. Conclusion: Our study highlights the significance of next-generation sequencing techniques in identifying novel ATMmutations in AT patients. Although all reported AT mutations reside in one gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 3 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of AT and underscores the potential clinical implications of identifying novel mutations. Further research in this area can help improve diagnosis and inform potential treatments for AT.