1. Construction of a strain containing the p62-GFP allele at the p62 gene locus For constructing the p62-GFP fusion, we used the following six primers to amplify wild type genomic DNA and the GFP-AfpyrG fusion from the plasmid pFNO3: P62GNC (5'-GGCTCCAGCGCCTGCACCAGCTCCTGAAGAACTGGAACTGCCAGC-3'), P62GNN (5'-CGAGTCTGAAGTTGCCATCATC-3'), P62GCN (5'-ATCAGTGCCTCCTCTCAGACAGTTCTCCTTCACCCTTATCTACTATATTC -3'), P62GCC (5'-GCATTGTTGTTAGGCAGTGGC -3'), GAGAF (5'-GGAGCTGGTGCAGGCGCTG -3') and pyrG3 (5'-CTGTCTGAGAGGAGGCACTGAT-3'). A fusion PCR was performed using P62GNN and P62GCC as primers to generate the 4.7 kb P62-GFP-AfpyrG fragment that we used to transform into XY42. Transformants were screened for GFP signals under microscope, and homologous integration was confirmed by PCR using primers AfpyrG5 (5'-AGCAAAGTGGACTGATAGC-3') and P62GCC2 (5'-TGGCAGCGAATGGAGGCATT-3'). Construction of a strain containing the p25-S allele at the p25 gene locus For constructing the p25-S fusion, we used the following six primers to amplify p25 open reading frame from the XY41 strain and the;The selected transformant was confirmed by PCR using AfpyrG5 and P50GCC as primers and by western blot analysis
2. The Saccharomyces cerevisiae homolog of p24 is essential for maintaining the association of p150Glued with the dynactin complex;I A Amaro;Genetics,2008
3. Dynein motion switches from diffusive to directed upon cortical anchoring;V Ananthanarayanan;Cell,2013
4. Vezatin, an integral membrane protein of adherens junctions, is required for the sound resilience of cochlear hair cells;A Bahloul;EMBO Mol Med,2009