First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States

Abstract

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5’ACATATATCAGAGAGAGCTCAGGTC3’ and PoLV-R 5’GCTCCCATGACAGACCTCACT3’) were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111–1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.