Role of sRNA molecules in the rye–leaf rust interaction

Abstract

Abstract Leaf rust (LR) caused by Puccinia recondita f. sp. secalis (Prs) is one of the most damaging diseases of rye. However, the genetic basis of the rye response to LR remains relatively unknown. Specifically, the involvement of small RNAs (sRNAs) in the rye–Prs interaction has not been characterized. In this study, the changes in various sRNAs in response to LR were revealed in three rye lines (D33, D39, and L318) that vary regarding their immune responses to LR and two Prs isolates that cause compatible (CP) or incompatible (ICP) interactions with the host. The sRNAs were analyzed using miRDeep2 and ShortStack algorithms, with true miRNAs detected on the basis of strict miRNA biosynthesis-related parameters. The differential expression of all sRNAs and miRNAs was analyzed and potential targets (i.e., mRNA) were detected. Additionally, the targets in the CP and ICP host–pathogen interactions were compared. Moreover, different isoforms of miRNAs originating from the same miRNA gene (isomiRs) were manually identified and the diversity in their potential targets were examined. The isomiRs can broaden the range of targets related to plant defense responses to pathogens. For example, UGUGUUCUCAGGUCGCCCCCG targets the transcripts of 11 endoglucanase genes and two superoxide dismutase genes, which encode proteins with plant defense-related functions. A shorter sequence (UCAGGUCGCCCCCGCUGGAG) was revealed to target 16 mRNAs encoding transcription factors, including those from the MADS box family. Finally, miRNA-like RNAs (milRNAs) from Prs and their predicted targets in rye were identified. To examine the effects of the experimental design, the differences in the number of milRNAs between CP and ICP interactions as well as the milRNA expression dynamics at two time-points were analyzed. Compared with the ICP interactions, the CP interactions resulted in more milRNAs, which affected many more genes, including some related to biotic stress responses.